About   Help   FAQ
Dock9em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dock9em1(IMPC)J
Name: dedicator of cytokinesis 9; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5804021
Synonyms: Dock9em1J
Gene: Dock9  Location: Chr14:121779458-122035249 bp, - strand  Genetic Position: Chr14, 65.28 cM
Alliance: Dock9em1(IMPC)J page
IMPC: Dock9 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Dock9-7743J-F670 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCCATAGCAGAGTATGACAC, TTGTCTGCTGGCCGTGTGGG, GCTGAACTTTTATGTCTCTA and AACCAGTGAAACACGACCCT, which resulted in a 439 bp deletion beginning at Chromosome 14 negative strand position 121,662,767 bp, GTCGTGTTTCACTGGTTCAG, and ending after GACCCAGTGTCATACTCTGC at 121,662,329 bp GRCm38/mm10). This mutation deletes exon 4 and 356 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an 8 bp insertion (TAACTCGG) at the deletion site, which will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 111 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dock9 Mutation:  91 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory