About   Help   FAQ
Sox9-pE, Sox9-pF Primer Detail
Primers
  • Name
    Sox9-pE, Sox9-pF
  • Primer 1 Sequence
    AAGAAAGACCACCCCGATTACA
  • Primer 2 Sequence
    CAGCGCCTTGAAGATAGCATT
  • ID
    MGI:3510977
  • Synonyms
    NG- Sox9-F, NG- Sox9-R
Genes
Sox9 SRY (sex determining region Y)-box 9
Expression
  • Assay Results
    67
References
J:93500 Bouma GJ, et al., Using real time RT-PCR analysis to determine multiple gene expression patterns during XX and XY mouse fetal gonad development. Gene Expr Patterns. 2004 Nov;5(1):141-9
J:183829 Correa SM, et al., Sex reversal in C57BL/6J XY mice caused by increased expression of ovarian genes and insufficient activation of the testis determining pathway. PLoS Genet. 2012 Apr;8(4):e1002569
J:238708 Gonen N, et al., Normal Levels of Sox9 Expression in the Developing Mouse Testis Depend on the TES/TESCO Enhancer, but This Does Not Act Alone. PLoS Genet. 2017 Jan;13(1):e1006520
J:332097 Chen Q, et al., Integration of 3D genome topology and local chromatin features uncovers enhancers underlying craniofacial-specific cartilage defects. Sci Adv. 2022 Nov 25;8(47):eabo3648

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory