About   Help   FAQ
Hmgic-pA1, Hmgic-pB1 Primer Detail
Primers
  • Name
    Hmgic-pA1, Hmgic-pB1
  • Primer 1 Sequence
    GCTACAGCTGAGGGACAGGC
  • Primer 2 Sequence
    CCAGCTGATTGTGGTCTTGG
  • ID
    MGI:892296
Genes
Hmga2 high mobility group AT-hook 2
Polymorphisms
J:28723 Cherath L, et al., Mamm Genome. 1995 Sep;6(9):611-6
Endonuclease Gene Allele Fragments Strains
Not Specified Hmga2 a 900bp A/J, BALB/cJ, DBA/1J, DBA/2J, I/LnJ, SEC/1ReJ
b 750bp AKR/J, BDP/J, BUB/BnJ, C3H/HeJ, C57BL/6J, CAST/EiJ, LP/J, M. spretus, MOLF/EiJ, NZW/BlNJ, P/J, SEA/GnJ, SJL/J
c >750bp SWR/J
d >750bp M. caroli
References
J:28723 Cherath L, et al., Identification and characterization of a novel conserved DNA repeat. Mamm Genome. 1995 Sep;6(9):611-6

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/17/2022
MGI 6.19
The Jackson Laboratory