About   Help   FAQ
Zfy2DF, Zfy2DR Primer Detail
Primers
  • Name
    Zfy2DF, Zfy2DR
  • Primer 1 Sequence
    CATTAAGACAGAAAAGACCACCG
  • Primer 2 Sequence
    GTGAGGAAATTTCTTCCTGTGG
  • ID
    MGI:8565
  • Region Covered
    18bp deletion in Zfy2
Genes
Zfy2 zinc finger protein 2, Y-linked
Polymorphisms
J:39317 Prager EM, et al., Mamm Genome. 1997 Apr;8(4):279-81
Endonuclease Gene Allele Fragments Strains
Not Specified Zfy2 d 202bp M. m. domesticus
m 202, 184bp M. m. musculus
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
Zfy2 a 202bp AKR/W, BN/aW
b 184, 202bp 129/SvW, A.CA/W, BALB/cW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
References
J:39317 Prager EM, et al., New assays for Y chromosome and p53 pseudogene clines among East Holstein house mice. Mamm Genome. 1997 Apr;8(4):279-81
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory