About   Help   FAQ
D2Tfv6F, D2Tfv6R Primer Detail
Primers
  • Name
    D2Tfv6F, D2Tfv6R
  • Primer 1 Sequence
    ATTCACACAGGTGCACATGC
  • Primer 2 Sequence
    GTAGGCACAACCCAGGTAGG
  • ID
    MGI:8468
  • Product Size
    104bp
  • Other IDs
    142342 (NCBI UniSTS)
  • Note
    Amplifies a portion of the left end of YAC FF1.F4.
Genes
D2Tfv6 DNA segment, Chr 2, Thomas F. Vogt 6
References
J:37225 Peichel CL, et al., Genetic and physical mapping of the mouse Ulnaless locus. Genetics. 1996 Dec;144(4):1757-67
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/18/2020
MGI 6.14
The Jackson Laboratory