About   Help   FAQ
481, 532 Primer Detail
Primers
  • Name
    481, 532
  • Primer 1 Sequence
    CCGTCCCTCTTAAGGAGCATTCTCC
  • Primer 2 Sequence
    CATTGGACCAGAGGCACTGTCTGCA
  • ID
    MGI:8455
  • Product Size
    818bp
Genes
Thbd thrombomodulin
Iap2-1 intracisternal A particles, Thbd linked
Polymorphisms
J:11839 Ford VA, et al., DNA Cell Biol. 1993 May;12(4):311-8
Endonuclease Gene Allele Fragments Strains
Thbd a absent A/J, C58/J, DBA/2J, M. m. molossinus, M. spretus
c 818bp 129P3/J, BALB/c, BALB/cByJ, C3H/Rl, C57L/J
References
J:11839 Ford VA, et al., An intracisternal A-particle DNA sequence is closely linked to the thrombomodulin gene in some strains of laboratory mice. DNA Cell Biol. 1993 May;12(4):311-8

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/26/2020
MGI 6.15
The Jackson Laboratory