About   Help   FAQ
R58 Primer Detail
Primers
  • Name
    R58
  • Primer 1 Sequence
    CACTTGGCATCAATCTCACTC
  • Primer 2 Sequence
    AAGATCATACCTATACCAGAAAC
  • ID
    MGI:84
  • Product Size
    97bp
  • Other IDs
    141780 (NCBI UniSTS)
Genes
D11Nds3 DNA segment, Chr 11, Nuffield Department of Surgery 3
Polymorphisms
J:3227 Cornall RJ, et al., Mamm Genome. 1992;3(11):620-4
Notes: Genomic DNA from the indicated strains was amplified via PCR, run on an 8% agarose gel and stained with ethidium bromide.
Endonuclease Gene Allele Fragments Strains
D11Nds3 a largest M. spretus
b 2nd largest B6.PL-Thy1a/SnJ, C57BL/6J, DBA/2J, NOD, NON
c 3rd largest AKR/J, C57BL/10-H2g7
References
J:3227 Cornall RJ, et al., Mouse microsatellites from a flow-sorted 4:6 Robertsonian chromosome. Mamm Genome. 1992;3(11):620-4
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/26/2020
MGI 6.15
The Jackson Laboratory