About   Help   FAQ
Mtap4-pA, Mtap4-pB Primer Detail
Primers
  • Name
    Mtap4-pA, Mtap4-pB
  • Primer 1 Sequence
    ACCTAAACCACTCCTTGACCC
  • Primer 2 Sequence
    GCCAAAACCAGCCTCTTGG
  • ID
    MGI:7911
  • Region Covered
    portion of 3' untranslated region
  • Product Size
    0.421kb
Genes
Map4 microtubule-associated protein 4
Polymorphisms
J:37418 Mangan ME, et al., Mamm Genome. 1996 Dec;7(12):918-9
Endonuclease Gene Allele Fragments Strains
PstI Map4 b 0.32,0.101kb C57BL/6J
s 0.421kb M. spretus
References
J:37418 Mangan ME, et al., The gene for microtubule-associated protein 4 (Mtap4) maps to the distal region of mouse chromosome 9. Mamm Genome. 1996 Dec;7(12):918-9

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/16/2021
MGI 6.16
The Jackson Laboratory