About   Help   FAQ
B2m-pA, B2m-pB Primer Detail
Primers
  • Name
    B2m-pA, B2m-pB
  • Primer 1 Sequence
    CACGCCACCCACCGGAGAATG
  • Primer 2 Sequence
    GATGCTGATCACATGTCTCG
  • ID
    MGI:7743
  • Product Size
    0.801kb
Genes
B2m beta-2 microglobulin
Polymorphisms
J:32426 Zuberi AR, et al., Genomics. 1996 Apr 1;33(1):75-84
Endonuclease Gene Allele Fragments Strains
BglI B2m b 0.575,0.266kb C57BL/6J
s 0.801kb CAST/EiJ, MEV/Ty, SPRET/EiJ
References
J:32426 Zuberi AR, et al., A genetic linkage map of mouse chromosome 2 extending from thrombospondin to paired box gene 1, including the H3 minor histocompatibility complex. Genomics. 1996 Apr 1;33(1):75-84

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory