About   Help   FAQ
Cntnap2-pE, Cntnap2-pF Primer Detail
Primers
  • Name
    Cntnap2-pE, Cntnap2-pF
  • Primer 1 Sequence
    GGAATGGAGAAGGTCACATCG
  • Primer 2 Sequence
    ACCAGAGAAAGGTATGCCTCC
  • ID
    MGI:7261403
  • Product Size
    470bp
Genes
Cntnap2 contactin associated protein-like 2
Expression
  • Assay Results
    3
References
J:229005 Gordon A, et al., Expression of Cntnap2 (Caspr2) in multiple levels of sensory systems. Mol Cell Neurosci. 2016 Jan;70:42-53

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/03/2022
MGI 6.21
The Jackson Laboratory