About   Help   FAQ
D3Mit62 Primer Detail
Primers
  • Name
    D3Mit62
  • Primer 1 Sequence
    TTCATTTGTTTATGCTTGGGG
  • Primer 2 Sequence
    TTCATCCTGTCCTCCTCTGG
  • ID
    MGI:707793
  • Product Size
    126
  • Other IDs
    129830 (NCBI UniSTS)
    D3Mit62 (BROAD)
  • Note
    MIT assay: MPC1295
Genes
D3Mit62 DNA segment, Chr 3, Massachusetts Institute of Technology 62
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit62 a 116bp A/J, BALB/cJ, C3H/HeJ
b 120bp DBA/2J, LP/J
c 128bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/26/2019
MGI 6.14
The Jackson Laboratory