About   Help   FAQ
D9Mit23 Primer Detail
Primers
  • Name
    D9Mit23
  • Primer 1 Sequence
    AAGAAGTTTCCATGACATCATGAA
  • Primer 2 Sequence
    AGAAGAAAATTCTTGACAGCTCTG
  • ID
    MGI:707773
  • Product Size
    205
  • Other IDs
    131792 (NCBI UniSTS)
    D9Mit23 (BROAD)
  • Note
    MIT assay: D4
Genes
D9Mit23 DNA segment, Chr 9, Massachusetts Institute of Technology 23
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit23 a 205bp NOD/MrkTac
b 206bp NON/ShiLt
c 207bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
d 290bp CAST/EiJ
e 320bp SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D9Mit23 l smaller LG/J
s ;arger SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/24/2020
MGI 6.15
The Jackson Laboratory