About   Help   FAQ
D12Mit226 Primer Detail
Primers
  • Name
    D12Mit226
  • Primer 1 Sequence
    TCACCAACTGGGAAACACAA
  • Primer 2 Sequence
    AGGGTCTCTGTCTATGTCTGGG
  • ID
    MGI:707700
  • Product Size
    121
  • Other IDs
    D12Mit226 (BROAD)
  • Note
    MIT assay: MT4876
    Additional information: MIT STS Marker Data Files
Genes
D12Mit226 DNA segment, Chr 12, Massachusetts Institute of Technology 226
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit226 a 108bp SPRET/EiJ
b 120bp CAST/EiJ
c 122bp NOD/MrkTac
d 124bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NON/ShiLt
e 126bp AKR/J, DBA/2J, LP/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Copyright, and Privacy Statement
Send questions and comments to User Support.
last database update
11/15/2022
MGI 6.22
The Jackson Laboratory