About   Help   FAQ
D9Mit191 Primer Detail
Primers
  • Name
    D9Mit191
  • Primer 1 Sequence
    GTAAGTATGCCTGCGGAGGA
  • Primer 2 Sequence
    CAGAAGACCGCTTTTCAAGG
  • ID
    MGI:707605
  • Product Size
    146
  • Other IDs
    116359 (NCBI UniSTS)
    D9Mit191 (BROAD)
  • Note
    MIT assay: MT2144
Genes
D9Mit191 DNA segment, Chr 9, Massachusetts Institute of Technology 191
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D9Mit191 a 147bp 129X1/Sv
f 99bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit191 a 99bp AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
b 115bp C57BL/6J
c 137bp A/J
d 147bp B6.Cg-Lepob/+, DBA/2J, SPRET/EiJ
e 157bp CAST/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D9Mit191 c larger C58/J
f not given FVB/NJ
i not given I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D9Mit191 c 98bp CBA/CaOlaHsd
s 88bp SWR/OlaHsd
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D9Mit191 c lower CBA/Kw
e upper KE
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/03/2020
MGI 6.15
The Jackson Laboratory