About   Help   FAQ
D8Mit9 Primer Detail
Primers
  • Name
    D8Mit9
  • Primer 1 Sequence
    ATTTGAATTGTGCAGACCTGG
  • Primer 2 Sequence
    CTGCTTGTTTTTATCTCCTGGG
  • ID
    MGI:707579
  • Product Size
    150
  • Other IDs
    131636 (NCBI UniSTS)
    D8Mit9 (BROAD)
  • Note
    MIT assay: A62
Genes
D8Mit9 DNA segment, Chr 8, Massachusetts Institute of Technology 9
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit9 m 155bp MOLF/EiJ
s 120bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit9 a 114bp SPRET/EiJ
b 118bp CAST/EiJ
c 139bp AKR/J
d 149bp BALB/cJ, C3H/HeJ, DBA/2J
e 151bp A/J, B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/23/2021
MGI 6.16
The Jackson Laboratory