About   Help   FAQ
D12Mit263 Primer Detail
Primers
  • Name
    D12Mit263
  • Primer 1 Sequence
    TCAGATCTCAGCAGATAAATACTTGG
  • Primer 2 Sequence
    TCCCCTGGAGCATATTTGAC
  • ID
    MGI:707225
  • Product Size
    113
  • Other IDs
    D12Mit263 (BROAD)
  • Note
    MIT assay: MTH915
    Additional information: MIT STS Marker Data Files
Genes
D12Mit263 DNA Segment, Chr 12, Massachusetts Institute of Technology 263
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit263 a 114bp B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac, SPRET/EiJ
b 122bp BALB/cJ, NON/ShiLt
c 124bp AKR/J
d 126bp C3H/HeJ, DBA/2J
e 130bp A/J, CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D12Mit263 a 122bp AKR/OlaHsd
b 108bp C57BL/6JOlaHsd, C57BL/10, SJL/J
c 118bp BALB/cJ
d 124bp 129P3/J, C3H/HeJ, DBA/2J
j 104bp JF1
p 128bp PWB
w 132bp A/JOlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory