About   Help   FAQ
D11Mit210 Primer Detail
Primers
  • Name
    D11Mit210
  • Primer 1 Sequence
    GGCCCCTGTCAGGGTATAAT
  • Primer 2 Sequence
    CAAACATGAGCCTTGGTCCT
  • ID
    MGI:707217
  • Product Size
    132
  • Other IDs
    126413 (NCBI UniSTS)
    D11Mit210 (BROAD)
  • Note
    MIT assay: D1236
Genes
D11Mit210 DNA segment, Chr 11, Massachusetts Institute of Technology 210
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit210 a 122bp CAST/EiJ
b 130bp B6.Cg-Lepob/+
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
04/06/2021
MGI 6.16
The Jackson Laboratory