D7Mit267 Primer Detail MGI Mouse MGI:707092

D7Mit267 Primer Detail

Name

D7Mit267
Primer 1 Sequence

CTCTTTCTGTTACATGGTTAGATTTCC
Primer 2 Sequence

AAAGACAGTTGAAGTTGACTTCTGG
ID

MGI:707092
Product Size

192
Other IDs

D7Mit267 (BROAD)
Note

MIT assay: MTAR173
Additional information: MIT STS Marker Data Files

D7Mit267

DNA segment, Chr 7, Massachusetts Institute of Technology 267

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit267	a	154bp	SPRET/EiJ
	b	182bp	A/J, AKR/J, BALB/cJ, DBA/2J, LP/J, NOD/MrkTac
	c	196bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J
	d	200bp	NON/ShiLt
	e	208bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D7Mit267	a	196bp	129/SvW, BN/aW, C3H/W, C57BL/6W, C57BL/10W
	D7Mit267	b	182bp	A.CA/W, AKR/W, BALB/cW, CBA/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23