About   Help   FAQ
D10Mit180 Primer Detail
Primers
  • Name
    D10Mit180
  • Primer 1 Sequence
    GACCTTCCTTTATACACAAGTCATAGC
  • Primer 2 Sequence
    GTGGTACAGAACTTAGGTGTTTAATTG
  • ID
    MGI:706913
  • Product Size
    134
  • Other IDs
    116623 (NCBI UniSTS)
    D10Mit180 (BROAD)
  • Note
    MIT assay: MT3119
Genes
D10Mit180 DNA segment, Chr 10, Massachusetts Institute of Technology 180
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit180 a 206bp 129X1/Sv
f 134, 206bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D10Mit180 c 206bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit180 a 108bp SPRET/EiJ
b 126bp CAST/EiJ
c 134bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
d 156bp A/J, BALB/cJ, DBA/2J, NOD/MrkTac
e 206bp AKR/J, C3H/HeJ, LP/J
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D10Mit180 a larger 129P3/J
s smaller SJL/J
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D10Mit180 c upper CBA/Kw
e lower KE
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/26/2019
MGI 6.14
The Jackson Laboratory