About   Help   FAQ
D10Mit180 Primer Detail
Primers
  • Name
    D10Mit180
  • Primer 1 Sequence
    GACCTTCCTTTATACACAAGTCATAGC
  • Primer 2 Sequence
    GTGGTACAGAACTTAGGTGTTTAATTG
  • ID
    MGI:706913
  • Product Size
    134
  • Other IDs
    D10Mit180 (BROAD)
  • Note
    MIT assay: MT3119
    Additional information: MIT STS Marker Data Files
Genes
D10Mit180 DNA segment, Chr 10, Massachusetts Institute of Technology 180
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit180 a 206bp 129X1/Sv
f 134, 206bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D10Mit180 c 206bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit180 a 108bp SPRET/EiJ
b 126bp CAST/EiJ
c 134bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
d 156bp A/J, BALB/cJ, DBA/2J, NOD/MrkTac
e 206bp AKR/J, C3H/HeJ, LP/J
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D10Mit180 a larger 129P3/J
s smaller SJL/J
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D10Mit180 c upper CBA/Kw
e lower KE
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/07/2024
MGI 6.23
The Jackson Laboratory