About   Help   FAQ
D10Mit233 Primer Detail
Primers
  • Name
    D10Mit233
  • Primer 1 Sequence
    GTGCTTTATATTGGAGATCATCACA
  • Primer 2 Sequence
    GTCCCGAATTTCACATACATAGC
  • ID
    MGI:706605
  • Product Size
    130
  • Other IDs
    126137 (NCBI UniSTS)
    D10Mit233 (BROAD)
  • Note
    MIT assay: MT4945
Genes
D10Mit233 DNA segment, Chr 10, Massachusetts Institute of Technology 233
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit233 b 0.130kb B10.BR-H2k, C57BL/6
c 0.110kb B10.D2-H2d, BALB/cAnNCr, BALB/cByJ, BALB/cJ
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit233 a 110bp 129X1/Sv
f 108, 110bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D10Mit233 b larger C57BL/6J
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit233 a 100bp NOD/MrkTac, SPRET/EiJ
b 108bp AKR/J, C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
c 110bp A/J, BALB/cJ
d 116bp CAST/EiJ
e 130bp B6.Cg-Lepob/+, C57BL/6J
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/14/2020
MGI 6.14
The Jackson Laboratory