About   Help   FAQ
DXMit144 Primer Detail
Primers
  • Name
    DXMit144
  • Primer 1 Sequence
    CCACGAAGCACAGAAGCAG
  • Primer 2 Sequence
    GAACATTTTAACATGCAATCTGTACC
  • ID
    MGI:706560
  • Product Size
    124
  • Other IDs
    132033 (NCBI UniSTS)
    DXMit144 (BROAD)
  • Note
    MIT assay: MJ4284
Genes
DXMit144 DNA segment, Chr X, Massachusetts Institute of Technology 144
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit144 a 110bp CAST/EiJ
b 116bp SPRET/EiJ
c 118bp A/J, BALB/cJ, C3H/HeJ, DBA/2J
d 124bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
DXMit144 c smaller CBA/Kw
e larger KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory