About   Help   FAQ
D2Mit444 Primer Detail
Primers
  • Name
    D2Mit444
  • Primer 1 Sequence
    AAAACTGCACGCAGGTACCT
  • Primer 2 Sequence
    GGTAAGCAGCATGACTGGGT
  • ID
    MGI:706484
  • Product Size
    175
  • Other IDs
    129354 (NCBI UniSTS)
    D2Mit444 (BROAD)
  • Note
    MIT assay: MTH1392
Genes
D2Mit444 DNA Segment, Chr 2, Massachusetts Institute of Technology 444
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit444 a 158bp SPRET/EiJ
b 160bp C3H/HeJ, CAST/EiJ, LP/J, NOD/MrkTac
c 176bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, DBA/2J, NON/ShiLt
d 178bp C57BL/6J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/11/2020
MGI 6.14
The Jackson Laboratory