About   Help   FAQ
D10Mit167.2 Primer Detail
Primers
  • Name
    D10Mit167.2
  • Primer 1 Sequence
    AAAGCAGAGGACAGCATTGG
  • Primer 2 Sequence
    TTCCCAACAGATGTGCATGT
  • ID
    MGI:706380
  • Product Size
    119
  • Other IDs
    126071 (NCBI UniSTS)
    D10Mit167.2 (BROAD)
  • Note
    MIT assay: D10Mit167.2
Genes
D10Mit167.2 DNA segment, Chr 10, Massachusetts Institute of Technology 167.2
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit167.2 a 94bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
b 116bp SPRET/EiJ
c 120bp BALB/cJ, C3H/HeJ, DBA/2J, LP/J
d 122bp A/J
e 126bp NOD/MrkTac
f 142bp CAST/EiJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/21/2020
MGI 6.14
The Jackson Laboratory