About   Help   FAQ
D15Mit6 Primer Detail
Primers
  • Name
    D15Mit6
  • Primer 1 Sequence
    CCTGGTCTGAAACACTTTTGC
  • Primer 2 Sequence
    CTTGTGAGTGCTCCATGCC
  • ID
    MGI:706112
  • Product Size
    127
  • Other IDs
    127679 (NCBI UniSTS)
    D15Mit6 (BROAD)
  • Note
    MIT assay: A59
Genes
D15Mit6 DNA segment, Chr 15, Massachusetts Institute of Technology 6
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit6 a 102bp CAST/EiJ, LP/J
b 104bp SPRET/EiJ
c 123bp C3H/HeJ
d 126bp NOD/MrkTac, NON/ShiLt
e 128bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
f 130bp A/J
g 132bp DBA/2J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D15Mit6 l smaller LG/J
s larger SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/31/2020
MGI 6.15
The Jackson Laboratory