About   Help   FAQ
D11Mit4 Primer Detail
Primers
  • Name
    D11Mit4
  • Primer 1 Sequence
    CAGTGGGTCATCAGTACAGCA
  • Primer 2 Sequence
    AAGCCAGCCCAGTCTTCATA
  • ID
    MGI:705870
  • Product Size
    249
  • Other IDs
    D11Mit4 (BROAD)
  • Note
    MIT assay: A124
    Additional information: MIT STS Marker Data Files
Genes
D11Mit4 DNA segment, Chr 11, Massachusetts Institute of Technology 4
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D11Mit4 c 242bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit4 a 238bp SPRET/EiJ
b 242bp BALB/cJ, C3H/HeJ, NON/ShiLt
c 244bp NOD/MrkTac
d 246bp C57BL/6J, CAST/EiJ
e 250bp B6.Cg-Lepob/+
f 300bp DBA/2J
g 306bp LP/J
h 307bp A/J, AKR/J
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D11Mit4 c larger C58/J
f not given FVB/NJ
i larger I/LnJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D11Mit4 l smaller LG/J
s larger SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit4 c 145bp CBA/CaOlaHsd
s 146bp SWR/OlaHsd
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit4 a larger 129P3/J
s smaller SJL/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory