About   Help   FAQ
D11Mit4 Primer Detail
Primers
  • Name
    D11Mit4
  • Primer 1 Sequence
    CAGTGGGTCATCAGTACAGCA
  • Primer 2 Sequence
    AAGCCAGCCCAGTCTTCATA
  • ID
    MGI:705870
  • Product Size
    249
  • Other IDs
    D11Mit4 (BROAD)
  • Note
    MIT assay: A124
    Additional information: MIT STS Marker Data Files
Genes
D11Mit4 DNA segment, Chr 11, Massachusetts Institute of Technology 4
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D11Mit4 c 242bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit4 a 238bp SPRET/EiJ
b 242bp BALB/cJ, C3H/HeJ, NON/ShiLt
c 244bp NOD/MrkTac
d 246bp C57BL/6J, CAST/EiJ
e 250bp B6.Cg-Lepob/+
f 300bp DBA/2J
g 306bp LP/J
h 307bp A/J, AKR/J
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D11Mit4 c larger C58/J
f not given FVB/NJ
i larger I/LnJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D11Mit4 l smaller LG/J
s larger SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit4 c 145bp CBA/CaOlaHsd
s 146bp SWR/OlaHsd
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit4 a larger 129P3/J
s smaller SJL/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/09/2022
MGI 6.21
The Jackson Laboratory