About   Help   FAQ
D10Mit213 Primer Detail
Primers
  • Name
    D10Mit213
  • Primer 1 Sequence
    CTCCTCCTACTGATTGTCCCC
  • Primer 2 Sequence
    GGGACAAACTTTTAAAAATTGCA
  • ID
    MGI:705729
  • Product Size
    150
  • Other IDs
    126115 (NCBI UniSTS)
    D10Mit213 (BROAD)
  • Note
    MIT assay: MJ4682
Genes
D10Mit213 DNA segment, Chr 10, Massachusetts Institute of Technology 213
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit213 a 128bp CAST/EiJ
b 136bp A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, SPRET/EiJ
c 150bp B6.Cg-Lepob/+, C57BL/6J
d 156bp AKR/J, NOD/MrkTac
e 160bp NON/ShiLt
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D10Mit213 c lower CBA/Kw
k upper KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/14/2020
MGI 6.14
The Jackson Laboratory