About   Help   FAQ
D7Mit298 Primer Detail
Primers
  • Name
    D7Mit298
  • Primer 1 Sequence
    CTGCTTTGTCCTGGAAAGCA
  • Primer 2 Sequence
    GCAGGTCTGATGACAAGAAGG
  • ID
    MGI:705288
  • Product Size
    107
  • Other IDs
    131197 (NCBI UniSTS)
    D7Mit298 (BROAD)
  • Note
    MIT assay: MTH627
Genes
D7Mit298 DNA segment, Chr 7, Massachusetts Institute of Technology 298
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit298 a 105bp DBA/2J
b 107bp A/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
c 109bp AKR/J, B6.Cg-Lepob/+, C57BL/6J
d 113bp SPRET/EiJ
e 115bp CAST/EiJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
06/30/2020
MGI 6.15
The Jackson Laboratory