About   Help   FAQ
D7Mit296 Primer Detail
Primers
  • Name
    D7Mit296
  • Primer 1 Sequence
    GGTCTTTCTTCCAAATGTACTTAATC
  • Primer 2 Sequence
    AGCACCTGAATTTAACAAGATGC
  • ID
    MGI:705286
  • Product Size
    125
  • Other IDs
    131195 (NCBI UniSTS)
    D7Mit296 (BROAD)
  • Note
    MIT assay: MTH581
Genes
D7Mit296 DNA segment, Chr 7, Massachusetts Institute of Technology 296
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit296 a 123bp SPRET/EiJ
b 125bp BALB/cJ, CAST/EiJ, DBA/2J
c 127bp A/J, AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
06/23/2020
MGI 6.15
The Jackson Laboratory