About   Help   FAQ
D14Mit133 Primer Detail
Primers
  • Name
    D14Mit133
  • Primer 1 Sequence
    TTGTCAAATAATTGCATGAGGC
  • Primer 2 Sequence
    AACTATGACTCAGATTCCAAGTTGG
  • ID
    MGI:705206
  • Product Size
    137
  • Other IDs
    127239 (NCBI UniSTS)
    D14Mit133 (BROAD)
  • Note
    MIT assay: MT900
Genes
D14Mit133 DNA segment, Chr 14, Massachusetts Institute of Technology 133
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit133 a 117bp A/J, AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
b 131bp CAST/EiJ
c 139bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J
d 184bp SPRET/EiJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/26/2019
MGI 6.14
The Jackson Laboratory