About   Help   FAQ
D12Mit143 Primer Detail
Primers
  • Name
    D12Mit143
  • Primer 1 Sequence
    CCCTATGCATGTACATTGTGAA
  • Primer 2 Sequence
    CGTGGGCATTTATCTTTCCT
  • ID
    MGI:704969
  • Product Size
    147
  • Other IDs
    126699 (NCBI UniSTS)
    D12Mit143 (BROAD)
  • Note
    MIT assay: MT1437
Genes
D12Mit143 DNA segment, Chr 12, Massachusetts Institute of Technology 143
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit143 a 124bp SPRET/EiJ
b 138bp CAST/EiJ
c 142bp NON/ShiLt
d 146bp B6.Cg-Lepob/+, C57BL/6J, LP/J
e 148bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J
f 154bp NOD/MrkTac
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/26/2020
MGI 6.15
The Jackson Laboratory