About   Help   FAQ
D15Mit112 Primer Detail
Primers
  • Name
    D15Mit112
  • Primer 1 Sequence
    TAATAACCTGAGGCCTATTCTTGG
  • Primer 2 Sequence
    ATGTTTGTGTGTATACTCATGATTGTG
  • ID
    MGI:704941
  • Product Size
    132
  • Other IDs
    D15Mit112 (BROAD)
  • Note
    MIT assay: MT993
    Additional information: MIT STS Marker Data Files
Genes
D15Mit112 DNA segment, Chr 15, Massachusetts Institute of Technology 112
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit112 a 114bp CAST/EiJ
b 130bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
c 132bp SPRET/EiJ
d 146bp LP/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Copyright, and Privacy Statement
Send questions and comments to User Support.
last database update
11/26/2022
MGI 6.22
The Jackson Laboratory