About   Help   FAQ
D2Mit12 Primer Detail
Primers
  • Name
    D2Mit12
  • Primer 1 Sequence
    CTACTTCCCAGGTGCTTGGA
  • Primer 2 Sequence
    TCCAAAGAACTGAATGGACA
  • ID
    MGI:704836
  • Product Size
    200
  • Other IDs
    142319 (NCBI UniSTS)
    D2Mit12 (BROAD)
  • Note
    MIT assay: M179
Genes
D2Mit12 DNA segment, Chr 2, Massachusetts Institute of Technology 12
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D2Mit12 a largest C57BL/6, JF1, MSM/Ms
b smaller DBA/2
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/18/2020
MGI 6.14
The Jackson Laboratory