About   Help   FAQ
D3Mit206.1 Primer Detail
Primers
  • Name
    D3Mit206.1
  • Primer 1 Sequence
    AAGTCTCTGACTTGGGCTCTCTT
  • Primer 2 Sequence
    CTGGCAGGTCTCATCAGGACTA
  • ID
    MGI:704767
  • Product Size
    113
  • Other IDs
    129627 (NCBI UniSTS)
    D3Mit206.1 (BROAD)
  • Note
    MIT assay: D3Mit206.1
Genes
D3Mit206.1 DNA segment, Chr 3, Massachusetts Institute of Technology 206.1
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/17/2019
MGI 6.14
The Jackson Laboratory