D19Mit53 Primer Detail MGI Mouse MGI:704138

D19Mit53 Primer Detail

Name

D19Mit53
Primer 1 Sequence

GCACGCCACAACTCAGAG
Primer 2 Sequence

AGAAAAGGTTCTCCTACCTCTCG
ID

MGI:704138
Product Size

111
Other IDs

D19Mit53 (BROAD)
Note

MIT assay: MT154
Additional information: MIT STS Marker Data Files

D19Mit53

DNA segment, Chr 19, Massachusetts Institute of Technology 53

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit53	a	110bp	129X1/Sv
Not Specified	D19Mit53	f	100, 110bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit53	a	98bp	A/J, BALB/cJ, DBA/2J
	b	100bp	AKR/J, NOD/MrkTac, NON/ShiLt
	c	102bp	C3H/HeJ
	d	106bp	B6.Cg-Lep^ob/+
	e	110bp	C57BL/6J, CAST/EiJ, LP/J
	f	118bp	SPRET/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit53	c	144bp	CBA/CaOlaHsd
	D19Mit53	s	137bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 01/06/2026 MGI 6.24