About   Help   FAQ
D19Mit53 Primer Detail
Primers
  • Name
    D19Mit53
  • Primer 1 Sequence
    GCACGCCACAACTCAGAG
  • Primer 2 Sequence
    AGAAAAGGTTCTCCTACCTCTCG
  • ID
    MGI:704138
  • Product Size
    111
  • Other IDs
    116499 (NCBI UniSTS)
    D19Mit53 (BROAD)
  • Note
    MIT assay: MT154
Genes
D19Mit53 DNA segment, Chr 19, Massachusetts Institute of Technology 53
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit53 a 110bp 129X1/Sv
f 100, 110bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit53 a 98bp A/J, BALB/cJ, DBA/2J
b 100bp AKR/J, NOD/MrkTac, NON/ShiLt
c 102bp C3H/HeJ
d 106bp B6.Cg-Lepob/+
e 110bp C57BL/6J, CAST/EiJ, LP/J
f 118bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D19Mit53 c 144bp CBA/CaOlaHsd
s 137bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/11/2020
MGI 6.14
The Jackson Laboratory