About   Help   FAQ
D14Mit223.1 Primer Detail
Primers
  • Name
    D14Mit223.1
  • Primer 1 Sequence
    TAGCTCCTGGCTTCTCCTTC
  • Primer 2 Sequence
    CTCCTGAGAACAACTGGAAAACAAT
  • ID
    MGI:704063
  • Product Size
    110
  • Other IDs
    D14Mit223.1 (BROAD)
  • Note
    MIT assay: D14Mit223.1
    Additional information: MIT STS Marker Data Files
Genes
D14Mit223.1 DNA segment, Chr 14, Massachusetts Institute of Technology 223.1
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit223.1 a 102bp SPRET/EiJ
b 116bp C57BL/6J
c 118bp B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
d 122bp AKR/J, NOD/MrkTac
e 138bp CAST/EiJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/03/2022
MGI 6.21
The Jackson Laboratory