About   Help   FAQ
Due to maintenance, access to MGI may be intermittent 7:30-8:30 AM EDT Thursday, May 28.
D1Mit227 Primer Detail
Primers
  • Name
    D1Mit227
  • Primer 1 Sequence
    TAACAAGTGAAGTCCATGGGC
  • Primer 2 Sequence
    AGGGGAGACAGGGACAGG
  • ID
    MGI:704020
  • Product Size
    147
  • Other IDs
    128569 (NCBI UniSTS)
    D1Mit227 (BROAD)
  • Note
    MIT assay: MT1511
Genes
D1Mit227 DNA segment, Chr 1, Massachusetts Institute of Technology 227
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit227 a 148bp A/J, B6.Cg-Lepob/+, C57BL/6J
b 154bp NOD/MrkTac
c 156bp BALB/cJ, DBA/2J, NON/ShiLt
d 158bp CAST/EiJ
e 172bp LP/J
f 174bp AKR/J
g 176bp C3H/HeJ, SPRET/EiJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/19/2020
MGI 6.15
The Jackson Laboratory