About   Help   FAQ
D19Mit116 Primer Detail
Primers
  • Name
    D19Mit116
  • Primer 1 Sequence
    CACCAGACACATACATAGCAAGC
  • Primer 2 Sequence
    TTCCTTCCCCTCTTTCTTCC
  • ID
    MGI:703807
  • Product Size
    123
  • Other IDs
    128330 (NCBI UniSTS)
    D19Mit116 (BROAD)
  • Note
    MIT assay: MTH2647
Genes
D19Mit116 DNA Segment, Chr 19 Massachusetts Institute of Technology 116
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit116 a 124bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NOD/MrkTac
b 136bp SPRET/EiJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/31/2020
MGI 6.15
The Jackson Laboratory