About   Help   FAQ
D12Mit51 Primer Detail
Primers
  • Name
    D12Mit51
  • Primer 1 Sequence
    CCTTGGAAGGGGCTTCTTC
  • Primer 2 Sequence
    AGGGTGGACCATTGTCTCAG
  • ID
    MGI:703601
  • Product Size
    139
  • Other IDs
    126873 (NCBI UniSTS)
    D12Mit51 (BROAD)
  • Note
    MIT assay: B659
Genes
D12Mit51 DNA segment, Chr 12, Massachusetts Institute of Technology 51
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit51 a 140bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
b 152bp NOD/MrkTac
c 154bp SPRET/EiJ
d 162bp CAST/EiJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/26/2020
MGI 6.15
The Jackson Laboratory