About   Help   FAQ
D4Mit214 Primer Detail
Primers
  • Name
    D4Mit214
  • Primer 1 Sequence
    CCCTACAAGTTGTCCTCTGACC
  • Primer 2 Sequence
    CACCAGTGTTGAGAGCAGGA
  • ID
    MGI:703594
  • Product Size
    125
  • Other IDs
    D4Mit214 (BROAD)
  • Note
    MIT assay: MT2939
    Additional information: MIT STS Marker Data Files
Genes
D4Mit214 DNA segment, Chr 4, Massachusetts Institute of Technology 214
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit214 a 116bp SPRET/EiJ
b 126bp B6.Cg-Lepob/+, C57BL/6J
c 128bp AKR/J, LP/J, NOD/MrkTac, NON/ShiLt
d 152bp C3H/HeJ, DBA/2J
e 154bp CAST/EiJ
f 158bp A/J
g 160bp BALB/cJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D4Mit214 c larger C58/J
f not given FVB/NJ
i larger I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D4Mit214 c 96bp CBA/CaOlaHsd
s 97bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
10/12/2021
MGI 6.17
The Jackson Laboratory