About   Help   FAQ
D4Mit341.1 Primer Detail
Primers
  • Name
    D4Mit341.1
  • Primer 1 Sequence
    CCTTCAGCATATAGAAATACCTTGC
  • Primer 2 Sequence
    ATCACAATCACAGTCTCACTTCC
  • ID
    MGI:703486
  • Product Size
    203
  • Other IDs
    130133 (NCBI UniSTS)
  • Note
    MIT assay: D4Mit341.1
Genes
D4Mit341a DNA segment, Chr 4, Massachusetts Institute of Technology 341a
D4Mit341b DNA segment, Chr 4, Massachusetts Institute of Technology 341b
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit341a a 126bp SPRET/EiJ
b 132bp LP/J, NOD/MrkTac, NON/ShiLt
c 150bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
d 152bp CAST/EiJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory