About   Help   FAQ
D2Mit295 Primer Detail
Primers
  • Name
    D2Mit295
  • Primer 1 Sequence
    AAGCCAACCTCAATCCAATG
  • Primer 2 Sequence
    GTCCTGACACACAGCAGCAT
  • ID
    MGI:703294
  • Product Size
    109
  • Other IDs
    D2Mit295 (BROAD)
  • Note
    MIT assay: MT3390
    Additional information: MIT STS Marker Data Files
Genes
D2Mit295 DNA segment, Chr 2, Massachusetts Institute of Technology 295
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit295 a 74bp SPRET/EiJ
b 88bp CAST/EiJ
c 92bp A/J
d 114bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
e 162bp C3H/HeJ
J:104037 Grzmil P, et al., MGI Direct Data Submission. 2006;
Endonuclease Gene Allele Fragments Strains
D2Mit295 c lower CBA/Kw
k upper KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:104037 Grzmil P, et al., Mapping of mouse Chromosome 2, 11 STS markers in CBXE and EXCB RI strains. MGI Direct Data Submission. 2006;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
04/16/2024
MGI 6.23 		The Jackson Laboratory