About   Help   FAQ
D3Mit310 Primer Detail
Primers
  • Name
    D3Mit310
  • Primer 1 Sequence
    CTCCTGACCTACAAGGGCAC
  • Primer 2 Sequence
    CCTGTATGTATGTTGTGCACCG
  • ID
    MGI:703239
  • Product Size
    88
  • Other IDs
    129747 (NCBI UniSTS)
    D3Mit310 (BROAD)
  • Note
    MIT assay: MTH1355
Genes
D3Mit310 DNA Segment, Chr 3, Massachusetts Institute of Technology 310
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit310 a 78bp A/J, C3H/HeJ
b 80bp BALB/cJ, DBA/2J, SPRET/EiJ
c 84bp AKR/J, NOD/MrkTac
d 88bp B6.Cg-Lepob/+, C57BL/6J, LP/J, NON/ShiLt
e 106bp CAST/EiJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/12/2019
MGI 6.14
The Jackson Laboratory