About   Help   FAQ
D7Mit89 Primer Detail
Primers
  • Name
    D7Mit89
  • Primer 1 Sequence
    CCTCTGTTACAGTCAGTGGTTAAA
  • Primer 2 Sequence
    GGCTTTTATTTCCATATATGGGG
  • ID
    MGI:702685
  • Product Size
    145
  • Other IDs
    131296 (NCBI UniSTS)
    D7Mit89 (BROAD)
  • Note
    MIT assay: MPC1043
Genes
D7Mit89 DNA segment, Chr 7, Massachusetts Institute of Technology 89
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D7Mit89 c 152bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit89 a 140bp CAST/EiJ
b 146bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J, NON/ShiLt
c 152bp AKR/J, C3H/HeJ, NOD/MrkTac
d 156bp DBA/2J
e 164bp SPRET/EiJ
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
06/30/2020
MGI 6.15
The Jackson Laboratory