About   Help   FAQ
D12Mit5 Primer Detail
Primers
  • Name
    D12Mit5
  • Primer 1 Sequence
    CACATAGACCAGACAGGCATGCGT
  • Primer 2 Sequence
    CAAGGTCACGTTGCTAGCTAGGAA
  • ID
    MGI:702642
  • Product Size
    48
  • Other IDs
    126871 (NCBI UniSTS)
    D12Mit5 (BROAD)
  • Note
    MIT assay: l58
Genes
D12Mit5 DNA segment, Chr 12, Massachusetts Institute of Technology 5
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D12Mit5 a 160bp 129X1/Sv
f 160, 176bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D12Mit5 c 160bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit5 a 141bp SPRET/EiJ
b 160bp A/J, AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J, LP/J
c 176bp B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac
d 178bp NON/ShiLt
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D12Mit5 l smaller LG/J
s larger SM/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/26/2020
MGI 6.15
The Jackson Laboratory