About   Help   FAQ
D11Mit155 Primer Detail
Primers
  • Name
    D11Mit155
  • Primer 1 Sequence
    GCAGGGTCCTGTCCAATG
  • Primer 2 Sequence
    AAAGCACCAATAACACATGGG
  • ID
    MGI:702348
  • Product Size
    115
  • Other IDs
    D11Mit155 (BROAD)
  • Note
    MIT assay: MT1185
    Additional information: MIT STS Marker Data Files
Genes
D11Mit155a DNA segment, Chr 11, Massachusetts Institute of Technology 155a
D11Mit155b DNA segment, Chr 11, Massachusetts Institute of Technology 155b
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit155a a 103bp SPRET/EiJ
b 115bp CAST/EiJ
c 117bp B6.Cg-Lepob/+
d 121bp AKR/J, BALB/cJ, C57BL/6J, NOD/MrkTac
e 123bp A/J, C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/03/2022
MGI 6.21
The Jackson Laboratory