About   Help   FAQ
D15Mit185 Primer Detail
Primers
  • Name
    D15Mit185
  • Primer 1 Sequence
    ATTGGGGACTTTGATCATTCC
  • Primer 2 Sequence
    AAGTGATATGACAGGCACTACACA
  • ID
    MGI:702298
  • Product Size
    118
  • Other IDs
    127554 (NCBI UniSTS)
    D15Mit185 (BROAD)
  • Note
    MIT assay: MTAR127
Genes
D15Mit185 DNA segment, Chr 15, Massachusetts Institute of Technology 185
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit185 a 120bp BALB/cJ, C3H/HeJ, DBA/2J, LP/J
b 122bp A/J, AKR/J, B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
c 156bp CAST/EiJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/26/2020
MGI 6.15
The Jackson Laboratory