About   Help   FAQ
D1Mit149 Primer Detail
Primers
  • Name
    D1Mit149
  • Primer 1 Sequence
    AAAGAGAATCTGACTTACCCATGG
  • Primer 2 Sequence
    TGTGAGGGAGAAGAATTATGTCTG
  • ID
    MGI:702250
  • Product Size
    150
  • Other IDs
    128486 (NCBI UniSTS)
    D1Mit149 (BROAD)
  • Note
    MIT assay: D703
Genes
D1Mit149 DNA segment, Chr 1, Massachusetts Institute of Technology 149
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit149 a 100bp B6.Cg-Lepob/+
b 118bp DBA/2J
c 120bp CAST/EiJ
d 140bp A/J
e 146bp AKR/J, BALB/cJ, C3H/HeJ, LP/J, NON/ShiLt
f 150bp NOD/MrkTac
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/19/2020
MGI 6.15
The Jackson Laboratory