About   Help   FAQ
D9Mit37 Primer Detail
Primers
  • Name
    D9Mit37
  • Primer 1 Sequence
    GGAGTGTGCAGGGGAAGATA
  • Primer 2 Sequence
    TGGATTCTCTCCACCCCTC
  • ID
    MGI:701923
  • Product Size
    142
  • Other IDs
    D9Mit37 (BROAD)
  • Note
    MIT assay: D564
    Additional information: MIT STS Marker Data Files
Genes
D9Mit37a DNA segment, Chr 9, Massachusetts Institute of Technology 37a
D9Mit37b DNA segment, Chr 9, Massachusetts Institute of Technology 37b
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit37a a 138bp CAST/EiJ
b 140bp B6.Cg-Lepob/+, C57BL/6J
c 146bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
d 154bp SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D9Mit37a l larger LG/J
s smaller SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
04/30/2024
MGI 6.23 		The Jackson Laboratory