About   Help   FAQ
D9Mit208 Primer Detail
Primers
  • Name
    D9Mit208
  • Primer 1 Sequence
    GCCTCTCTTTCTTTAAACACTTTAAG
  • Primer 2 Sequence
    CCTCCACACACCTGTTTGTG
  • ID
    MGI:701913
  • Product Size
    109
  • Other IDs
    D9Mit208 (BROAD)
  • Note
    MIT assay: MT3486
    Additional information: MIT STS Marker Data Files
Genes
D9Mit208 DNA segment, Chr 9, Massachusetts Institute of Technology 208
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit208 a 82bp CAST/EiJ
b 84bp A/J
c 86bp C3H/HeJ, NOD/MrkTac, NON/ShiLt
d 100bp LP/J
e 106bp DBA/2J
f 112bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/17/2022
MGI 6.19
The Jackson Laboratory