About   Help   FAQ
D13Mit199 Primer Detail
Primers
  • Name
    D13Mit199
  • Primer 1 Sequence
    CTTTACTGCCAATATAGGAAATATGC
  • Primer 2 Sequence
    GCTATCTCAAGTTGCCTTTAGACC
  • ID
    MGI:701391
  • Product Size
    149
  • Other IDs
    116545 (NCBI UniSTS)
    D13Mit199 (BROAD)
  • Note
    MIT assay: MT2647
Genes
D13Mit199 DNA segment, Chr 13, Massachusetts Institute of Technology 199
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit199 a 124bp CAST/EiJ
b 142bp SPRET/EiJ
c 148bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J
d 150bp DBA/2J
e 152bp AKR/J, LP/J, NOD/MrkTac, NON/ShiLt
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
03/24/2020
MGI 6.15
The Jackson Laboratory